Much attention has recently been focused on the inflammatory reaction in diseases such as asthma. Eosinophils, together with T lymphocytes, are considered to be the major inflammatory cells in asthma,1-6 since eosinophil specific granule proteins can damage bronchial mucosa cells resulting in bronchial hyperreactivity.7 Mononuclear cells (MNC) and platelets also have been implicated as important cells in the inflammatory reactions, since they are an excellent source of a wide range of biologically active materials of relevance to the inflammatory process.8-10

Recently, the members of the chemokine family are 8—10 kD basic heparin-binding polypeptides which are related in primary structure, in particular being characterized by the presence of a four-cysteine motif.11 Chemokines related to the beta subfamily, the so called C-C branch of platelet factor 4 (PF4)-related proteins12 have been shown to stimulate human eosinophils or basophils, and are considered important mediators of inflammation.11-13 Particularly, not only eotaxin but also RANTES has been considered to play an important role in various immune and allergic disorders,14, 15 since RANTES is a potent chemoattractant for various important inflammatory cells such as eosinophils16 as well as memory T cells and monocytes,17 potentially recruiting these cells from the circulation to an inflamed focus. Therefore, it is of great interest to study the source of RANTES production.

In this study, we examined the production of RANTES and eotaxin from peripheral blood mononuclear cells (PBMNC), cultured with specific allergen in patients with allergic asthma by a sandwich enzyme-linked immunosorbent assay (ELISA).

Twelve normal control subjects (19—58 years old, average age of 39.2 years) and 18 patients with bronchial asthma during attack as defined by the American Thoracic Society18 (16—61 years old, average age of 37.4 years) were involved in this study. All patients with asthma had mite-allergic asthma with an IgE RAST score for mite allergen of 3 or more with positive skin test.

PBMNC were collected from the heparinized peripheral venous blood of patients with mite-allergic asthma and that of normal control subjects, by Ficoll-Paque (Pharmacia, Uppsala, Sweden) centrifugation.

PBMNC isolated as described above were suspended in 2.0 mL of HBSS, anti-CD4 monoclonal antibody conjugated magnetic beads (Dynabeads, Dynal, Norway) were added at the proportion of 1 : 40 (MNC;anti-CD4 monoclonal antibody conjugated magnetic beads), and the mixture was incubated for 45 minutes at 4°C. These PBMNC that attached to the magnetic beads were subsequently reacted with a magnetic particle concentrator (MPC, Dynal, Norway) for 15 minutes, and then CD4 positive cells were removed to isolate the CD4 negative PBMNC. CD8 negative PBMNC were also isolated in the same manner, using anti-CD8 monoclonal antibody conjugated magnetic beads. Before being used for the experiments, the isolated CD4 and CD8 negative MNC were confirmed to contain <5% CD4 and CD8 positive MNC, respectively, by the indirect fluorescent antibody technique and a FACScan (Becton-Dickinson, Mountain View, CA, USA) as described elsewhere.10, 19

Cells were suspended at the concentration of 2 × 10⁶/mL in RPMI1640 (GIBCO, Grand Island, NY, USA) with 10% heat-inactivated fetal calf serum (FCS) (M.A. Biproducts, MD, USA) and antibiotics (100 μg/mL penicillin and 100 μg/mL streptomycin).19 Mite allergen, which was the mite extract Dermatophagoides farinae (Torii Pharmaceutical Co, Tokyo, Japan), was added at a final concentration of 10 μg/mL as previously described.19 The cells were cultured in the presence or absence of mite-allergen at 37°C in 5% CO₂ for 4 days (approximately for 84 hours) and then the supernatants were obtained as described previously.10-19

RANTES in the supernatant of PBMNC was measured by ELISA as previously reported.20 In brief, an ELISA kit (R & D systems, USA) with two antibodies to differentiate epitopes of RANTES was used for the assay. A 96-well plate was treated with anti-RANTES monoclonal antibody, and 100 μl of the standard solution or the test sample was added followed by 50 μl of horseradish peroxidase-labeled anti-RANTES antibody. Absorbance was determined at 450/540 nm with a Titertek Multiskan MCC/340 spectrophotometer (ICN, Labosystem Oy., Helsinki, Finland). A calibration curve was generated with the standard solution, and the RANTES concentration in each sample was determined from this curve (sensitivity 15.6 pg/ml or more). All determinations were performed in duplicate or triplicate.

The level of β-thromboglobulin (β-TG) in supernatants was assessed according to a method described in a previous study.21

The RANTES primers used were 5' primer, 5' CTGTCATCCTCATTGCTACT; and 3' primer, 5' ATCTCCAAAGAGTTGATGTAC (product size 244 bp). The eotaxin primers used were 5' primer, 5' GAAAGCTGTGATCTTCAAGAC; and 3' primer, 5' CATGCCCTTTGGACTGATAATGA (product size 224 bp). As a control, G3PDH primers were used (Clontech Co., USA).

Messenger RNA was isolated by the guanidinium thiocyanate method (QuickPrep Micro mRNA Purification kit, Pharmacia). A cDNA template for the polymerase chain reaction (PCR) was prepared by reverse transcription using mRNA and distilled water as negative control, Moloney murine leukemia virus (M-MuLV) reverse transcriptase, and random hexadeoxy-nucleotides (First-Strand cDNA product Synthesis kit; Pharmacia).

Six percent of each cDNA product was transferred to individual tubes to which were added one of the 22 5'-oligonucleotide primers, 30 pmol, and a reaction mixture containing water, buffer, 10 mmol./l, deoxynucleotide triphosphates, and Ampli-TaqR DNA polymerase (Perkin-Elmer). The reaction was carried out with a Perkin-Elmer Gene-Amp PCR system 9600. The PCR was started with an initial 45-second denaturation step at 94°C, followed by 35 cycles of 94°C denaturation for 10 seconds, annealing at 60°C for 10 seconds, extension for 10 seconds at 72°C, with a final extension step of 10 minutes at 72°C. The amplified products were separated on 12.5% polyacrylamide gels (PhastGel, Parmacia) stained with the silver staining method (PhastGel DNA Silver Staining kit, Pharmacia).22

Data were expressed as means ± SEM. Student's t test was used for comparison of means, and a P value of 0.05 or less was considered to indicate a significant difference.

The RANTES level of the supernatants of PBMNC cultured without mite-allergen in patients with mite-allergic asthma was 709.54 ± 171.74 pg/mL (mean ± SEM), while that in the control was 141.83 ± 22.92 pg/mL. The RANTES level in the patients was significantly higher than that in the controls in the culture condition without mite allergen (P < 0.01, Figure 1), whereas eotaxin was not detectable in any supernatant (data not shown).

In the culture condition with mite-allergen, the RANTES level in the supernatant of PBMNC cultured with mite-allergen in the patients was 1464.61 ± 218.87 pg/mL, whereas that in the controls was 152.81 ± 22.18 pg/mL. The RANTES level in the patients was significantly higher than that in the culture without mite allergen in the same patients (P < 0.01) and than in that the controls cultured with or without mite-allergen (P < 0.01, Figure 1), there being no significant differences between the controls cultured with mite allergen and without mite allergen (152.81 ± 22.18 vs 141.83 ± 22.92, P > 0.1, Figure 1).

Moreover, in the time course experiments, RANTES production from PBMNC in response to the specific allergen was significantly observed in the culture for 48 hours (Table 1, Figure 2, P < 0.01).

In addition, gene (mRNA) expression for RANTES was observed in PBMNC cultured with mite-allergen, whereas eotaxin mRNA was not observed (Figure 3).

To clarify the contamination of platelets, since platelets are an excellent source of RANTES,15, 17, 21 β-TG was also examined. In the culture condition with mite-allergen, the β-TG level in the patients showed no significant difference with that in the control (118.6 ± 30.1 IU/mL vs 122.8 ± 32.6 IU/mL, P > 0.1).

A comparative study on RANTES production between CD4 negative and CD8 negative PBMNC in response to mite allergen revealed no significant differences (CD4 negative: 1359.67 ± 230.76 vs CD8 negative: 1317.00 ± 221.84, P > 0.1, Figure 4)

The level of RANTES production from PBMNC of patients with asthma with peripheral blood eosinophilia (more than 8%) cultured without mite-allergen were 998.3 ± 268.54 (n = 10) pg/mL, while that from those without eosinophilia was 377.01 ± 77.68 (n = 8) pg/mL. The levels in the patients with eosinophilia were significantly higher than those in the patients without eosinophilia (P < 0.05, Figure 5) in the culture condition without specific allergen. Moreover, in response to the specific allergen, the level of RANTES production in the patients with eosinophilia was much more higher than that in the patients without eosinophilia (2014.20 ± 268.42 pg/mL (n = 10) vs 777.63 ± 156.86 pg/mL, n = 8, P < 0.01, Figure 5).

Together with lymphocytes, eosinophils prominently infiltrate in the bronchial mucosa of patients with asthma, and are thought to be the cause of epithelial damage and characteristic airway hyperreactivity.4, 5, 23, 24 Several stimuli have been implicated in their recruitment and recent studies suggest that lymphocytes of the Th2 type, which migrate together with eosinophils into sites of late-phase reactions,25 are an important source of chemoattractant cytokines and growth factors that prime eosinophils.26, 27

RANTES is a member of the 8-kD cytokine family that has been shown to possess selective chemotactic activity for eosinophils.17 Since RANTES attracts T lymphocytes of the memory type (CD45RO⁺)15 besides eosinophils, RANTES may be a common mechanism in various allergic or immunological reactions.28-34 The allergen-induced late phase airway reaction in atopic subjects, in which both memory T cell infiltration and eosinophil accumulation are characteristic,25, 35 might represent a possible clinical model.

In this context, it is of great interest to clarify the source of RANTES production as well as eotaxin.34 RANTES originally was identified as an apparently T cell-specific inducible gene, which was initially found to be expressed by cultured T cell lines that were antigen specific and growth factor dependent.36 The present findings revealed that MNC could produce RANTES but not eotaxin in response to a specific allergen in asthma patients. Our present results of RANTES production from MNC of patients agree with a previous report of a murine model.37 Eotaxin is also one of the most important chemokines. However, it may not be generated by MNC but by cytokines such as IL-4 produced from MNC.38 We also examined the β-TG level to clarify the possible contamination by platelets, since they are an excellent source of RANTES.15 No significant differences in β-TG levels were observed.

Moreover, in the present time course study, the RANTES production from MNC in response to the specific allergen was also revealed to apparently be observed after 48 hours. However, RANTES release from MNC without allergen in patients with asthma was elevated as compared with that of controls with or without mites, suggesting that the PBMNC of patients may have been stimulated in vivo. These findings suggest that RANTES plays a key role in the airway inflammation in the late asthmatic response in which eosinophilia is characterized.25, 35 Indeed, RANTES production from PBMNC of asthma patients with eosinophilia was greater than that of patients without eosinophilia.

Moreover, in this study, no significant differences in RANTES production between CD4 negative cells and CD8 negative cells were observed, in contrast with the role of CD4 positive cells in IL-5 production as we previously reported.39

While it was reported that RANTES was produced predominantly by CD8⁺ as compared with CD4⁺,40 our present results suggest, as one of several possible explanations, that not only CD8 positive cells but also CD4 positive cells may be together involved in the production of RANTES or that PBMNC which are neither for CD4 nor for CD8 such as monocytes/macrophages may be involved. Indeed, expression of RANTES was initially considered to be T-cell specific.36 However, subsequent studies have revealed that RANTES can be expressed by a broad range of cell types such as synovial fibroblasts,41 monocytes/macrophages42, 43 and platelets.17

Taken together, these findings suggest that MNC play a crucial role in the pathogenesis, in particular in eosinophil and T lymphocyte recruitment into the inflamed focus of asthma through RANTES production in response to specific allergen. The details of the mechanism of production of RANTES from MNC in the pathogenesis of bronchial asthma need to be further investigated.

ACKNOWLEDGEMENTS

Hajime Oyamada and Junichi Chihara contributed equally to this study. We gratefully acknowledge Dr. T Yamashita and Miss Y Nakamura for their expert participation in the experimental protocol of the RANTES assay. We thank Miss Y Ohyama for secretarial assistance.

REFERENCES

1
Bousquet J, Chanez P, Lacoste JY et al. Eosinophilic inflammation in asthma. N. Engl. J. Med. 1990; 323: 1033-1038.
 

2
Chihara J. Molecular mechanisms of eosinophil activation in allergic diseases. Clin. Exp. All. Rev. 2005; 5: 46-49.

3
Lee JJ, Dimina D, Macias MP et al. Defining a link with asthma in mice congenitally deficient in eosinophils. Science 2004; 305: 1773-1776.
 

4
Rothenberg ME. Eosinophilia. N. Engl. J. Med. 1998; 338: 1592-1600.

5
Nagai H. Immunopharmacological approach to elucidation the mechanism of allergic inflammation. Allergol. Int. 2005; 54: 251-261.

6
Terada N, Gorai S, Kim WJ et al. Mechanisms of eosinophilic inflammation in the mucosa of the nasal cavity and paranasal sinus. Allergol. Int. 2001; 50: 273-279.

7
Gleich GJ, Adolphson CR. The eosinophilic leukocyte. Adv. Immuno. 1986; 39: 177-253.

8
Page CP. Platelet as inflammatory cells. Immunopharmacology 1989; 17: 51-59.

9
Capron A, Ameisen JC, Joseph M et al. New functions for platelets and their pathological implications. Int. Arch. Allergy Immunol. 1985; 77: 107-114.

10
Chihara J, Kurachi D, Yamamoto T et al. Induction of β₂ integrin expression on an eosinophilic cell line (EoL-l) by the supernatant of mononuclear cells stimulated with specific allergen from asthmatic patients. Immunol. Lett. 1994; 42: 25-29.
 

11
Baggiolini M, Dahinden CA. CC chemokines in allergic inflammation. Immunology Today 1994; 15: 127-133.
 

12
Stoeckle MY, Barker KA. Two burgeoning families of platelet factor 4-related proteins; Mediators of the inflammatory response. The New Biologist 1990; 4: 313-323.

13
Schall TJ. Biology of the RANTES/SIS cytokine family. Cytokine 1991; 3: 165-183.
 

14
Bisset LR, Schmid-Grendelmeier P. Chemokines and their receptors in the pathogenesis of allergic asthma: progress and perspective. Curr. Opin. Pulm. Med. 2005; 11: 35-42.
 

15
Schall TJ, Bacon K, Toy KJ et al. Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature 1990; 347: 669-671.
 

16
McLean A. Regulation of RANTES. Lancet 1994; 343: 189-190.
 

17
Kameyoshi Y, Doorschner A, Mallet AI et al. Cytokine RANTES released by thrombin-stimulated platelets is a potent attractant for human eosinophils. J. Exp. Med. 1992; 176: 587-592.
 

18
American Thoracic Society. Pulmonary terms and symbols. Chest 1975; 67: 583-589.

19
Chihara J, Nakano N, Kurachi D et al. Induction of IgE-Fc receptor (FcR₂/CD23) expression on lymphocytes from patients with mite-allergic bronchial asthma by mite allergen. Ann. Allergy 1991; 67: 429-432.
 

20
Chihara J, Yamada H, Takamura E et al. Possible presence of RANTES in the tear of patients with allergic conjunctivitis. Int. Arch. Allergy Immunol. 1995; 106: 428-429.
 

21
Chihara J, Yasuba H, Tsuda A et al. Elevation of the plasma level of RANTES during asthma attacks. J. Allergy Clin. Immunol. 1997; 100: S52-55.
 

22
Chihara J, Oyamada H, Yamada H et al. Expression of mRNA for RANTES in human eosinophils. Int. Arch. Allergy Immunol. 1997; 114 (S1) : 33-35.
 

23
Djukanovic R, Roche WR, Wilson JW et al. Mucosal inflammation in asthma. Am. Rev. Respir. Dis. 1990; 142: 434-457.
 

24
Lampinen M, Carlson M, Hakansson LD et al. Cytokine-regulated accumulation of eosinophils in inflammatory disease. Allergy 2004; 59: 793-805.
 

25
Frew AJ, Kay AB. UCHLl (CD45RO⁺) memory T cells predominate in the CD4 cellular infiltrate associated with allergen-induced late-phase skin reactions in atopic subjects. Clin. Exp. Immunol. 1991; 84: 270-274.
 

26
Frew AJ, Kay AB. The relationship between infiltrating CD4 lymphocytes, activated eosinophils, and the magnitude of the allergen-induced late phase cutaneous reaction in man. J. Immunol. 1988; 141: 4158-4164.
 

27
Kay AB, Ying S, Varney V et al. Messenger RNA expression of the cytokine gene cluster, interleukin 3 (IL-3), IL-4, IL-5, and in allergen-induced late-phase cutaneous reactions in atopic subjects. J. Exp. Med. 1991; 173: 775-778.
 

28
Chihara J, Yamada H, Yamamoto T et al. Priming effect of RANTES on eosinophil oxidative metabolism. Allergy 1998; 53: 1178-1182.
 

29
Alam R, Stafford S, Forsythe P et al. RANTES is chemotactic and activating factor for human eosinophils. J. Immunol. 1993; 150: 3442-3448.
 

30
Kulmburg PA, Huber NE, Scheer BJ et al. Immunoglobulin E plus antigen challenge induces a novel intercrine/chemokine in mouse mast cells. J. Exp. Med. 1992; 176: 1773-1778.
 

31
Tanaka Y, Adams DH, Hubscher S et al. T-cell adhesion induced by proteoglycan-immobilized cytokine MIP-l. Nature 1993; 361: 79-82.
 

32
Taub DD, Conlon K, Lloyd AR et al. Preferential migration of activated CD4 and CD8 T cells in response to MIP-l and MIP-l. Science 1993; 260: 355-358.
 

33
Zhang L, Redington AE, Holgate ST. RANTES; a novel mediator of allergic inflammation. Clin. Exp. Allergy 1994; 24: 899-904.
 

34
Pods R, Ross D, van Hulst S et al. RANTES, eotaxin and eotaxin-2 expression and production in patients with aspirin triad. Allergy 2003; 58: 1165-1170.
 

35
Frew AJ, Kay AB. Eosinophils and T-lymphocytes in late phase allergic reactions. J. Allergy Clin. Immunol. 1990; 85: 533-539.
 

36
Schall TJ, Jongstra J, Dyer BJ et al. A human T cell-specific molecule is a member of a new gene family. J. Immunol. 1988; 141: 1018-1025.
 

37
Kawano T, Matsuse H, Kondo Y et al. Cysteinyl leukotrienes induce nuclear factor κB activation and RANTES production in a murine model of asthma. J. Allergy Clin. Immunol. 2003; 112: 369-374.
 

38
Watanabe K, Jose PJ, Rankin SM. Eotaxin-2 generation is differentially regulated by lipopolysaccharide and IL-4 in monocytes and macropages. J. Immunol. 2002; 168: 1911-1918.
 

39
Fahy O, Hammad H, Senechal S et al. Synergistic effect of diesel organic extracts and allergen Der p I on the release of chemokines by peripheral blood mononuclear cells from allergic subjects. Am. J. Respir. Cell Mol. Biol. 2000; 23: 247-254.
 

40
Chihara J, Kurachi D, Yamamoto T et al. [Role of CD4 positive mononuclear cells in IL-5 production in response to specific allergen in asthma.] Jpn. J. Allergology 1992; 41: 1017 (Abstract in Japanese).

41
Hariharan D, Ho W, Cutilli J et al. C-C chemokine profile of cord blood mononuclear cell. Blood 2000; 95: 715-718.
 

42
Rathanaswami P, Hachicha M, Sadick M et al. Expression of the cytokine RANTES in human synovial rheumatoid fibroblasts; differential regulation of RANTES and interleukin-8 genes by inflammatory cytokines. J. Biol. Chem. 1993; 268: 5834-5839.
 

43
Devergne O, Koka AM, Schall TJ et al. Production of the RANTES chemokine in Delayed-type hypersensitivity reactions; involvement of macrophages and endothelial cells. J. Exp. Med. 1994; 179: 1689-1694.